ID: 1127573045_1127573047

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1127573045 1127573047
Species Human (GRCh38) Human (GRCh38)
Location 15:60262799-60262821 15:60262820-60262842
Sequence CCCAGGCTGGAGTGCTCACTGTA TACCTTGACCTCCCAGACTCAGG
Strand - +
Off-target summary {0: 5, 1: 41, 2: 54, 3: 89, 4: 700} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!