ID: 1127679379_1127679388

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1127679379 1127679388
Species Human (GRCh38) Human (GRCh38)
Location 15:61277986-61278008 15:61278028-61278050
Sequence CCTACCTCGGCCTCCCAAAATGT CACCGCGCCCGGCTTACCATTGG
Strand - +
Off-target summary {0: 163, 1: 5348, 2: 61364, 3: 220755, 4: 280074} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!