ID: 1127679383_1127679388

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1127679383 1127679388
Species Human (GRCh38) Human (GRCh38)
Location 15:61277999-61278021 15:61278028-61278050
Sequence CCCAAAATGTTGAGATTACAGGC CACCGCGCCCGGCTTACCATTGG
Strand - +
Off-target summary {0: 112, 1: 3269, 2: 44589, 3: 279817, 4: 277696} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!