ID: 1127753520_1127753534

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1127753520 1127753534
Species Human (GRCh38) Human (GRCh38)
Location 15:62068284-62068306 15:62068318-62068340
Sequence CCCGGGCCCCCTCCACGAGCCCG GGTCCCGTTTCCCGAGCGCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 342} {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!