ID: 1128314504_1128314511

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1128314504 1128314511
Species Human (GRCh38) Human (GRCh38)
Location 15:66652193-66652215 15:66652237-66652259
Sequence CCTCAGTTTCCCCATCTGTCAAT GAGGACCCCTCCTGACCTCGTGG
Strand - +
Off-target summary {0: 3, 1: 77, 2: 789, 3: 4011, 4: 11033} {0: 1, 1: 0, 2: 0, 3: 10, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!