ID: 1128314507_1128314509

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1128314507 1128314509
Species Human (GRCh38) Human (GRCh38)
Location 15:66652204-66652226 15:66652218-66652240
Sequence CCATCTGTCAATGAGTTAGACCA GTTAGACCAGGAGAGCTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 91} {0: 1, 1: 0, 2: 2, 3: 13, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!