ID: 1128358889_1128358892

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1128358889 1128358892
Species Human (GRCh38) Human (GRCh38)
Location 15:66946698-66946720 15:66946716-66946738
Sequence CCAGAAAGGGATTCTGGAACTCT ACTCTGGAGGCTGAAGACACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 10, 3: 161, 4: 1754}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!