ID: 1128367856_1128367860

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1128367856 1128367860
Species Human (GRCh38) Human (GRCh38)
Location 15:67017357-67017379 15:67017396-67017418
Sequence CCTGGGCAACAATAGCAAAACTC AAAAAAGAAAAGATGCAGCTGGG
Strand - +
Off-target summary {0: 56, 1: 10573, 2: 20973, 3: 30076, 4: 23642} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!