ID: 1128502010_1128502014

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1128502010 1128502014
Species Human (GRCh38) Human (GRCh38)
Location 15:68233249-68233271 15:68233282-68233304
Sequence CCTGGGCTAAGACAAAGATCTTT CAATGTATGAAACACCTACGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 187} {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!