ID: 1129162217_1129162237

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1129162217 1129162237
Species Human (GRCh38) Human (GRCh38)
Location 15:73753159-73753181 15:73753209-73753231
Sequence CCCTGCCCCGCCGGGCTCCCGGG GCGCCGCGCCGCCCGCGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 455} {0: 1, 1: 1, 2: 12, 3: 78, 4: 548}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!