ID: 1129162236_1129162263

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1129162236 1129162263
Species Human (GRCh38) Human (GRCh38)
Location 15:73753204-73753226 15:73753256-73753278
Sequence CCGCGGCGCCGCGCCGCCCGCGC CCCCGCCGGACTGGCCGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 16, 3: 126, 4: 809} {0: 1, 1: 0, 2: 2, 3: 13, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!