ID: 1129162253_1129162273

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1129162253 1129162273
Species Human (GRCh38) Human (GRCh38)
Location 15:73753243-73753265 15:73753278-73753300
Sequence CCGCCCCGCCGCCCCCCGCCGGA GCGGGCGCTGGCTCCCTTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 165, 4: 1238} {0: 1, 1: 0, 2: 0, 3: 5, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!