ID: 1129292784_1129292791

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1129292784 1129292791
Species Human (GRCh38) Human (GRCh38)
Location 15:74581172-74581194 15:74581192-74581214
Sequence CCCGCCCCCATCAGTTCTCTTCA TCAAGGCTGCAAACTGACCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 289} {0: 1, 1: 0, 2: 0, 3: 17, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!