ID: 1129342777_1129342783

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1129342777 1129342783
Species Human (GRCh38) Human (GRCh38)
Location 15:74897110-74897132 15:74897135-74897157
Sequence CCCCTAGCTCCAGCAAGGACAGG CTTTCTCCCAACACGGAGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 212} {0: 1, 1: 0, 2: 2, 3: 8, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!