|
Left Crispr |
Right Crispr |
Crispr ID |
1129449781 |
1129449790 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
15:75644727-75644749
|
15:75644771-75644793
|
Sequence |
CCCAGGAGTTTGAGATCAGCCTG |
CTATACAAAAATACAAAAGTTGG |
Strand |
- |
+ |
Off-target summary |
{0: 884, 1: 12151, 2: 22105, 3: 30653, 4: 26485} |
{0: 1, 1: 2, 2: 52, 3: 296, 4: 1081} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|