ID: 1129452104_1129452108

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1129452104 1129452108
Species Human (GRCh38) Human (GRCh38)
Location 15:75656928-75656950 15:75656954-75656976
Sequence CCTCACACGCTGTCCTCTGCTCT TATGCCAGGCGCCTTCGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 326} {0: 1, 1: 0, 2: 0, 3: 5, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!