ID: 1129454841_1129454849

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1129454841 1129454849
Species Human (GRCh38) Human (GRCh38)
Location 15:75671079-75671101 15:75671100-75671122
Sequence CCTGCCTCTCCCATTTTAGTGTC TCCCCTAATTAAAGGGTGAGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!