ID: 1129462955_1129462958

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1129462955 1129462958
Species Human (GRCh38) Human (GRCh38)
Location 15:75709104-75709126 15:75709123-75709145
Sequence CCTGAGAAGCGGAGAGAGCTAGG TAGGAACCCTTGCCCCACGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 161} {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!