ID: 1129597919_1129597927

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1129597919 1129597927
Species Human (GRCh38) Human (GRCh38)
Location 15:76979356-76979378 15:76979384-76979406
Sequence CCTGCTTGGCCTGCCGCAGGGCG CAGCTCGGACAACTTGGCATTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 17, 3: 46, 4: 276} {0: 1, 1: 4, 2: 11, 3: 15, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!