ID: 1129737910_1129737914

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1129737910 1129737914
Species Human (GRCh38) Human (GRCh38)
Location 15:77976071-77976093 15:77976092-77976114
Sequence CCTCCTGCCAAGGACATCATCGA GACTTCCCCTTGGTGCTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 6, 4: 101} {0: 1, 1: 0, 2: 0, 3: 15, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!