ID: 1129780177_1129780182

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1129780177 1129780182
Species Human (GRCh38) Human (GRCh38)
Location 15:78264732-78264754 15:78264745-78264767
Sequence CCGGCCTCGCCCGCCCCCCCCGC CCCCCCCCGCAGACACAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 22, 3: 300, 4: 2319} {0: 1, 1: 0, 2: 1, 3: 9, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!