ID: 1129810822_1129810828

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1129810822 1129810828
Species Human (GRCh38) Human (GRCh38)
Location 15:78508209-78508231 15:78508236-78508258
Sequence CCTTGGGGTTGAACTGCCCCGTG TGTGGAATGAAGGTCACCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 92} {0: 1, 1: 0, 2: 0, 3: 11, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!