ID: 1129814402_1129814406

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1129814402 1129814406
Species Human (GRCh38) Human (GRCh38)
Location 15:78539495-78539517 15:78539546-78539568
Sequence CCCAAAAGTGTGAACCTGATCAT AGTGTCTTTCTCTGTCACCCAGG
Strand - +
Off-target summary No data {0: 11, 1: 786, 2: 19296, 3: 76592, 4: 147905}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!