ID: 1129854156_1129854161

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1129854156 1129854161
Species Human (GRCh38) Human (GRCh38)
Location 15:78811906-78811928 15:78811921-78811943
Sequence CCCTCCCTGGACAGACAGCGGTT CAGCGGTTGCCCGCGCGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 127} {0: 1, 1: 0, 2: 1, 3: 3, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!