ID: 1129854157_1129854163

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1129854157 1129854163
Species Human (GRCh38) Human (GRCh38)
Location 15:78811907-78811929 15:78811923-78811945
Sequence CCTCCCTGGACAGACAGCGGTTG GCGGTTGCCCGCGCGAGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106} {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!