ID: 1130211808_1130211815

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1130211808 1130211815
Species Human (GRCh38) Human (GRCh38)
Location 15:81930834-81930856 15:81930880-81930902
Sequence CCGCTGCACCCAACCAAGTCTAC ACTGCCAGTGAACTGCACGTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 14, 3: 162, 4: 1244} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!