ID: 1130370848_1130370855

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1130370848 1130370855
Species Human (GRCh38) Human (GRCh38)
Location 15:83284459-83284481 15:83284491-83284513
Sequence CCCAGCGGCGTCCCGGGCCGCCT ACAGAGAATCCCCGCGCCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 130} {0: 1, 1: 0, 2: 0, 3: 3, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!