ID: 1130370850_1130370856

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1130370850 1130370856
Species Human (GRCh38) Human (GRCh38)
Location 15:83284470-83284492 15:83284494-83284516
Sequence CCCGGGCCGCCTGCTCCGCGCAC GAGAATCCCCGCGCCCGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 281} {0: 1, 1: 0, 2: 1, 3: 3, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!