ID: 1130370851_1130370863

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1130370851 1130370863
Species Human (GRCh38) Human (GRCh38)
Location 15:83284471-83284493 15:83284512-83284534
Sequence CCGGGCCGCCTGCTCCGCGCACA GGAGGGCGCCGCGCTTACCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 213} {0: 1, 1: 0, 2: 0, 3: 6, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!