|
Left Crispr |
Right Crispr |
| Crispr ID |
1130403270 |
1130403274 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:83576992-83577014
|
15:83577024-83577046
|
| Sequence |
CCTCCGTCTCCTTGGTTCAAGTG |
CCTCAGCCTTCTGAGTAGCTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 470, 2: 10453, 3: 51683, 4: 119056} |
{0: 4034, 1: 105705, 2: 210194, 3: 239846, 4: 148354} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|