ID: 1130681969_1130681970

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1130681969 1130681970
Species Human (GRCh38) Human (GRCh38)
Location 15:86004911-86004933 15:86004924-86004946
Sequence CCATACTAGCTCAGGGTGAACAA GGGTGAACAAGCTTTTCCAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!