ID: 1130918232_1130918233

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1130918232 1130918233
Species Human (GRCh38) Human (GRCh38)
Location 15:88322794-88322816 15:88322808-88322830
Sequence CCTGGGAGGGCTCAGGGTGGCTA GGGTGGCTAGATTTCAGCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 225} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!