ID: 1130990890_1130990895

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1130990890 1130990895
Species Human (GRCh38) Human (GRCh38)
Location 15:88875054-88875076 15:88875082-88875104
Sequence CCGAGGGTAAGCCGGCAGGAGAG TCAGAGGGACCTCCGCTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 163} {0: 1, 1: 0, 2: 1, 3: 19, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!