ID: 1130991185_1130991191

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1130991185 1130991191
Species Human (GRCh38) Human (GRCh38)
Location 15:88877095-88877117 15:88877114-88877136
Sequence CCACTAGGCCAGCACCCAGGACC GACCGGGTGAACCATTGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 231} {0: 1, 1: 0, 2: 0, 3: 3, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!