ID: 1131049119_1131049128

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1131049119 1131049128
Species Human (GRCh38) Human (GRCh38)
Location 15:89334715-89334737 15:89334742-89334764
Sequence CCAGGCCCACGGCACGGCGTCCC CGCGCGGCCTACGCAGCCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 145} {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!