ID: 1131049126_1131049134

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1131049126 1131049134
Species Human (GRCh38) Human (GRCh38)
Location 15:89334738-89334760 15:89334768-89334790
Sequence CCTTCGCGCGGCCTACGCAGCCT GCGTGTGGCCTCCACCCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 34} {0: 1, 1: 0, 2: 1, 3: 11, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!