ID: 1131098540_1131098542

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1131098540 1131098542
Species Human (GRCh38) Human (GRCh38)
Location 15:89670924-89670946 15:89670947-89670969
Sequence CCTGTTTGTGGGAAGGGTAGATA GTTGGTCAGTGAGATAGATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 131} {0: 1, 1: 0, 2: 2, 3: 16, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!