ID: 1131196645_1131196649

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1131196645 1131196649
Species Human (GRCh38) Human (GRCh38)
Location 15:90360682-90360704 15:90360699-90360721
Sequence CCCACACAGGGGTGAAGCCTTAC CCTTACAGGTGTAATGACTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 104} {0: 1, 1: 6, 2: 120, 3: 168, 4: 435}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!