ID: 1131228206_1131228213

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1131228206 1131228213
Species Human (GRCh38) Human (GRCh38)
Location 15:90642508-90642530 15:90642525-90642547
Sequence CCACTGATCTCCGTCCGCACCGA CACCGAAGGCGGGCCCGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 29} {0: 1, 1: 0, 2: 0, 3: 6, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!