ID: 1131347953_1131347958

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1131347953 1131347958
Species Human (GRCh38) Human (GRCh38)
Location 15:91668622-91668644 15:91668646-91668668
Sequence CCTGTGACAGGTGGCCCAGATCT CAAAGATGGTGCTGTGAGTAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 15, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!