ID: 1131347955_1131347960 |
View in Genome Browser |
Spacer: 7 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1131347955 | 1131347960 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 15:91668636-91668658 | 15:91668666-91668688 |
Sequence | CCCAGATCTTCAAAGATGGTGCT | GGGAATAATCATGTTTTACTGGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 0, 2: 0, 3: 12, 4: 225} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |