ID: 1131703793_1131703801

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1131703793 1131703801
Species Human (GRCh38) Human (GRCh38)
Location 15:94970850-94970872 15:94970873-94970895
Sequence CCGTGCCCTCCGTGTCCTCCTCG GTGTGCTGATAGAAGTGAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 380} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!