ID: 1131880184_1131880189

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1131880184 1131880189
Species Human (GRCh38) Human (GRCh38)
Location 15:96854073-96854095 15:96854087-96854109
Sequence CCCTCCCCTATATGCTCATCCTA CTCATCCTAAAACACAGAACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 21, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!