ID: 1131882004_1131882006

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1131882004 1131882006
Species Human (GRCh38) Human (GRCh38)
Location 15:96871831-96871853 15:96871849-96871871
Sequence CCATTTTCATGCGCGTCCGTGTG GTGTGAAGAGACCACCAAACAGG
Strand - +
Off-target summary No data {0: 1170, 1: 1149, 2: 398, 3: 94, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!