ID: 1131882004_1131882009

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1131882004 1131882009
Species Human (GRCh38) Human (GRCh38)
Location 15:96871831-96871853 15:96871868-96871890
Sequence CCATTTTCATGCGCGTCCGTGTG CAGGCTTTGTGTGAGCAACATGG
Strand - +
Off-target summary No data {0: 1153, 1: 517, 2: 138, 3: 64, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!