ID: 1132273347_1132273357

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1132273347 1132273357
Species Human (GRCh38) Human (GRCh38)
Location 15:100544974-100544996 15:100545026-100545048
Sequence CCTTACACAACCTCTTCAGAAGG ATAGGAAGGGGAAGCCCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 148} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!