ID: 1132359661_1132359665

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1132359661 1132359665
Species Human (GRCh38) Human (GRCh38)
Location 15:101201819-101201841 15:101201854-101201876
Sequence CCTTTCCTGAACTGTGTTCAAAG TGCCTTCATGTTCTCCCAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 194} {0: 1, 1: 0, 2: 1, 3: 18, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!