ID: 1132449892_1132449906

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1132449892 1132449906
Species Human (GRCh38) Human (GRCh38)
Location 15:101961460-101961482 15:101961502-101961524
Sequence CCACGAGGACAGCGCTCCGGGTC GCTCGGGGAGGGCGCAGCGGAGG
Strand - +
Off-target summary No data {0: 5, 1: 1, 2: 4, 3: 41, 4: 424}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!