ID: 1132559956_1132559967

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1132559956 1132559967
Species Human (GRCh38) Human (GRCh38)
Location 16:589118-589140 16:589160-589182
Sequence CCGGGTCTTGAGCTCGCGCCGGC GCTGTGGCGGCCGCGTCCCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!