ID: 1132692216_1132692222

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1132692216 1132692222
Species Human (GRCh38) Human (GRCh38)
Location 16:1186709-1186731 16:1186738-1186760
Sequence CCTCCTCAACGGGTGGCCACGTA CCTGGCCGGTGAATGTGCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 28} {0: 1, 1: 0, 2: 0, 3: 10, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!